Sequence retrieval

Genome: Yersinia pestis KIM
Start position: 2154660
End position: 2154710
Length: 51

DNA sequence
>NC_004088, from 2154660 to 2154710 (51 bp); Yersinia pestis KIM ACAAAGTTTTTAATAACAAATAGTTTTTAATAACAAACAGTTTTTACTAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2154707-2155621	Sequence	y1952 - hypothetical protein (Protein is coded in complementary strand; from 2155621 to 2154707)