Sequence retrieval

Genome: Yersinia pestis KIM
Start position: 3638219
End position: 3638269
Length: 51

DNA sequence
>NC_004088, from 3638219 to 3638269 (51 bp); Yersinia pestis KIM ATACTGTTACCCTTAAATATTGTTACCTTTAAATACTGTTGTCTTTAAATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 3637604-3638221	Sequence	y3305 - arginine exporter protein (Protein is coded in complementary strand; from 3638221 to 3637604)