Sequence retrieval

Genome: Yersinia pestis KIM
Start position: 4386912
End position: 4386962
Length: 51

DNA sequence
>NC_004088, from 4386912 to 4386962 (51 bp); Yersinia pestis KIM ATCAAACAGTGCTTCATCAAATAGCACTTCATCAAACAGTGTCTTATCAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4386661-4387050	Sequence	y3931 - hypothetical protein (Protein is coded in complementary strand; from 4387050 to 4386661)