Sequence retrieval

Genome: Yersinia pestis KIM
Start position: 3095669
End position: 3095720
Length: 52

DNA sequence
>NC_004088, from 3095669 to 3095720 (52 bp); Yersinia pestis KIM CAATTAACCAATTAACCAATTAACCAATTAACCAATTAACCAATTAACCAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3095713-3097005	Sequence	y2796 serS seryl-tRNA synthetase (Protein is coded in complementary strand; from 3097005 to 3095713)