Sequence retrieval

Genome: Yersinia pestis KIM
Start position: 1321693
End position: 1321745
Length: 53

DNA sequence
>NC_004088, from 1321693 to 1321745 (53 bp); Yersinia pestis KIM TCTGCTTCAACTAATCTGTTTCAACTAACCTGTTTCAACTAATCTGCTTCAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1321732-1323627	Sequence	y1178 mrdA penicillin-binding protein 2 (Protein is coded in complementary strand; from 1323627 to 1321732)