Sequence retrieval

Genome: Streptococcus agalactiae NEM316
Start position: 1108679
End position: 1108702
Length: 24

DNA sequence
>NC_004368, from 1108679 to 1108702 (24 bp); Streptococcus agalactiae NEM316 ATTGGTATTGCTTTTGGTCTTGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1107986-1111957	Sequence	gbs1068 - FtsK/SpoIIIE family protein (Protein is coded in complementary strand; from 1111957 to 1107986)