Sequence retrieval

Genome: Streptococcus agalactiae NEM316
Start position: 1342471
End position: 1342494
Length: 24

DNA sequence
>NC_004368, from 1342471 to 1342494 (24 bp); Streptococcus agalactiae NEM316 ACAATAATAATAACAATAAAAATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1341772-1343112	Sequence	gbs1296 - MATE efflux family protein (Protein is coded in complementary strand; from 1343112 to 1341772)