Sequence retrieval

Genome: Streptococcus agalactiae NEM316
Start position: 1589798
End position: 1589847
Length: 50

DNA sequence
>NC_004368, from 1589798 to 1589847 (50 bp); Streptococcus agalactiae NEM316 GAAGCACTGGTTGAAGCACTGGTTGAAGCACTGGTTGAAGCACTGGTTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1588571-1592503	Sequence	gbs1529 - cell wall surface anchor family protein (Protein is coded in complementary strand; from 1592503 to 1588571)