Sequence retrieval

Genome: Streptococcus agalactiae NEM316
Start position: 1755606
End position: 1755632
Length: 27

DNA sequence
>NC_004368, from 1755606 to 1755632 (27 bp); Streptococcus agalactiae NEM316 ATCTTCTTCATTTTCTTCAGCTTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1755577-1755981	Sequence	gbs1698 - hypothetical protein (Protein is coded in complementary strand; from 1755981 to 1755577)