Sequence retrieval

Genome: Streptococcus agalactiae NEM316
Start position: 1953258
End position: 1953287
Length: 30

DNA sequence
>NC_004368, from 1953258 to 1953287 (30 bp); Streptococcus agalactiae NEM316 AATCCAAAATAATCTAAAAAAATCAAAACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1951803-1953707	Sequence	gbs1885 - hypothetical protein (Protein is coded in complementary strand; from 1953707 to 1951803)