Sequence retrieval

Genome: Streptococcus agalactiae NEM316
Start position: 2090170
End position: 2090222
Length: 53

DNA sequence
>NC_004368, from 2090170 to 2090222 (53 bp); Streptococcus agalactiae NEM316 TCTGGCTTAGCTTCTGGCTTAGCTTCTGGCTTAGCTTCTGGCTTAGCTTCTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2089843-2091774	Sequence	gbs2018 - peptidoglycan linked protein (Protein is coded in complementary strand; from 2091774 to 2089843)