Sequence retrieval

Genome: Helicobacter hepaticus ATCC 51449
Start position: 1072793
End position: 1072816
Length: 24

DNA sequence
>NC_004917, from 1072793 to 1072816 (24 bp); Helicobacter hepaticus ATCC 51449 AAAGAGAAAAGCGAAAAGAAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1072686-1074260	Sequence	HH1103 cydA cytochrome bd quinol oxidase (Protein is coded in complementary strand; from 1074260 to 1072686)