Sequence retrieval

Genome: Helicobacter hepaticus ATCC 51449
Start position: 1424929
End position: 1424953
Length: 25

DNA sequence
>NC_004917, from 1424929 to 1424953 (25 bp); Helicobacter hepaticus ATCC 51449 TCTTCTTCATCTTCTTCCTCATCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1424875-1425672	Sequence	HH1488 tatC Sec-independent protein secretion pathway component TatC (Protein is coded in complementary strand; from 1425672 to 1424875)