Sequence retrieval

Genome: Helicobacter hepaticus ATCC 51449
Start position: 804805
End position: 804830
Length: 26

DNA sequence
>NC_004917, from 804805 to 804830 (26 bp); Helicobacter hepaticus ATCC 51449 AAAAGCAAAGAAAAGCAAAGAAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 804005-804859	Sequence	HH0827 - hypothetical protein (Protein is coded in complementary strand; from 804859 to 804005)