Sequence retrieval

Genome: Helicobacter hepaticus ATCC 51449
Start position: 1457008
End position: 1457047
Length: 40

DNA sequence
>NC_004917, from 1457008 to 1457047 (40 bp); Helicobacter hepaticus ATCC 51449 TTAATTATTTCTTAATTATTTCTTAATTATTTCTTAATTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1457046-1457633	Sequence	HH1518 recR recombination protein RecR (Protein is coded in complementary strand; from 1457633 to 1457046)