Sequence retrieval

Genome: Helicobacter hepaticus ATCC 51449
Start position: 182127
End position: 182171
Length: 45

DNA sequence
>NC_004917, from 182127 to 182171 (45 bp); Helicobacter hepaticus ATCC 51449 AGTTTGAGCTTCTTTATTTTGTGCCTCTTTAGCTTGAGATTCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 181393-182301	Sequence	HH0186 - hypothetical protein (Protein is coded in complementary strand; from 182301 to 181393)