Sequence retrieval

Genome: Helicobacter hepaticus ATCC 51449
Start position: 39576
End position: 39620
Length: 45

DNA sequence
>NC_004917, from 39576 to 39620 (45 bp); Helicobacter hepaticus ATCC 51449 CTCCTCAAGCGAATAATCATTAAGCGAATAATCATTAAGCGAATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 37606-39801	Sequence	HH0033 feoB ferrous ion uptake system protein (Protein is coded in complementary strand; from 39801 to 37606)