Sequence retrieval

Genome: Acinetobacter sp. ADP1
Start position: 154594
End position: 154635
Length: 42

DNA sequence
>NC_005966, from 154594 to 154635 (42 bp); Acinetobacter sp. ADP1 AATTTTCGTAATTTTCGTAATTTTCGTAATTTTCGTAATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 152162-154642	Sequence	ACIAD0152 - hypothetical protein (Protein is coded in complementary strand; from 154642 to 152162)