Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150
Start position: 1836917
End position: 1836941
Length: 25

DNA sequence
>NC_006511, from 1836917 to 1836941 (25 bp); Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150 GCTCCGGCACCGGCTCCGGCTCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1836306-1837358	Sequence	SPA1780 ompA outer membrane protein A