Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150
Start position: 199993
End position: 200041
Length: 49

DNA sequence
>NC_006511, from 199993 to 200041 (49 bp); Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150 GGCGAGATGGATCATGGCAACATGGATCACAGCGGGATGAATCATGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 198809-200419	Sequence	SPA0171 yacK multicopper oxidase