Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150
Start position: 2029120
End position: 2029150
Length: 31

DNA sequence
>NC_006511, from 2029120 to 2029150 (31 bp); Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150 TTCGCGCCAGTTCGCGGCATCGCGCGCCAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2028473-2029462	Sequence	SPA1950 moaA molybdenum cofactor biosynthesis protein A (Protein is coded in complementary strand; from 2029462 to 2028473)