Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150
Start position: 2201227
End position: 2201283
Length: 57

DNA sequence
>NC_006511, from 2201227 to 2201283 (57 bp); Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150 GTACTGGTACTGGTACTGGTACTGGTACTGGTACTGGTACTGGTACTGGTACTGGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2200082-2201587	Sequence	SPA2116 citT citrate carrier