Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150
Start position: 2515556
End position: 2515588
Length: 33

DNA sequence
>NC_006511, from 2515556 to 2515588 (33 bp); Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150 TGCGTTGGACAATCGTTGGACATCCGTTGGACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2515086-2515985	Sequence	SPA2411 gp18 DNA replication (Protein is coded in complementary strand; from 2515985 to 2515086)