Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150
Start position: 3002176
End position: 3002213
Length: 38

DNA sequence
>NC_006511, from 3002176 to 3002213 (38 bp); Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150 CACGACCATGACCATGACCATGACCATGACCATGACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3001811-3002635	Sequence	SPA2891 yohM inner membrane protein