Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150
Start position: 3002179
End position: 3002214
Length: 36

DNA sequence
>NC_006511, from 3002179 to 3002214 (36 bp); Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150 GACCATGACCATGACCATGACCATGACCATGACCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3001811-3002635	Sequence	SPA2891 yohM inner membrane protein