Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150
Start position: 3277959
End position: 3277982
Length: 24

DNA sequence
>NC_006511, from 3277959 to 3277982 (24 bp); Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150 TCGCTTTCGCTTTCTCTTCCGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3277685-3278857	Sequence	SPA3168 yhbZ GTP-binding protein (Protein is coded in complementary strand; from 3278857 to 3277685)