Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150
Start position: 3804482
End position: 3804508
Length: 27

DNA sequence
>NC_006511, from 3804482 to 3804508 (27 bp); Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150 GCAGCGCCAGCAGCGCCAGCGGCGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3804382-3804594	Sequence	SPA3666 ccmD heme exporter protein D1 (Protein is coded in complementary strand; from 3804594 to 3804382)