Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150
Start position: 4113134
End position: 4113165
Length: 32

DNA sequence
>NC_006511, from 4113134 to 4113165 (32 bp); Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150 CGCGGTAAATCTCGATAAATGGCGGTAAAACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4112023-4113174	Sequence	SPA3958 argE acetylornithine deacetylase (Protein is coded in complementary strand; from 4113174 to 4112023)