Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150
Start position: 693749
End position: 693775
Length: 27

DNA sequence
>NC_006511, from 693749 to 693775 (27 bp); Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150 TGGCGCCGCTGGCGCTGCTGGCGCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 693665-693877	Sequence	SPA0613 ccmD heme exporter protein D1