Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150
Start position: 982380
End position: 982407
Length: 28

DNA sequence
>NC_006511, from 982380 to 982407 (28 bp); Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150 GTTGCAGTCGATGCAGTCGATGCAGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 980724-982415	Sequence	SPA0901 fliF flagellar basal-body M-ring protein (Protein is coded in complementary strand; from 982415 to 980724)