Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 1015859
End position: 1015882
Length: 24

DNA sequence
>NC_007626, from 1015859 to 1015882 (24 bp); Magnetospirillum magneticum AMB-1 CCGAGTCCCAGTCCGAGCCCGAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1015748-1016059	Sequence	amb0954 - magnetic particle specific iron-binding protein (Protein is coded in complementary strand; from 1016059 to 1015748)