Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 1061180
End position: 1061203
Length: 24

DNA sequence
>NC_007626, from 1061180 to 1061203 (24 bp); Magnetospirillum magneticum AMB-1 GGCTCGGGCTCGGGTTCGGGCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1060439-1062067	Sequence	amb0998 - hypothetical protein (Protein is coded in complementary strand; from 1062067 to 1060439)