Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 1087103
End position: 1087126
Length: 24

DNA sequence
>NC_007626, from 1087103 to 1087126 (24 bp); Magnetospirillum magneticum AMB-1 GCCCAGACCCAGGCCGAGGCCCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1086996-1087619	Sequence	amb1027 - cell wall protein TIR3 precursor (Protein is coded in complementary strand; from 1087619 to 1086996)