Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 1211860
End position: 1211883
Length: 24

DNA sequence
>NC_007626, from 1211860 to 1211883 (24 bp); Magnetospirillum magneticum AMB-1 GGAATGCGAATGGCAATGGAAATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1211502-1212014	Sequence	amb1133 - hypothetical protein (Protein is coded in complementary strand; from 1212014 to 1211502)