Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 1345806
End position: 1345829
Length: 24

DNA sequence
>NC_007626, from 1345806 to 1345829 (24 bp); Magnetospirillum magneticum AMB-1 CAGCAGCACCAGCAGCGGCGGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1345315-1346361	Sequence	amb1262 - hypothetical protein (Protein is coded in complementary strand; from 1346361 to 1345315)