Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 1586755
End position: 1586778
Length: 24

DNA sequence
>NC_007626, from 1586755 to 1586778 (24 bp); Magnetospirillum magneticum AMB-1 AGGGCCAGGGGCAGTGCCAGGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1585621-1587138	Sequence	amb1454 - Lipid A core - O-antigen ligase and related enzyme (Protein is coded in complementary strand; from 1587138 to 1585621)