Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 1617788
End position: 1617811
Length: 24

DNA sequence
>NC_007626, from 1617788 to 1617811 (24 bp); Magnetospirillum magneticum AMB-1 CATCACCAGCACCACCACCATCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1617711-1618289	Sequence	amb1480 - hypothetical protein (Protein is coded in complementary strand; from 1618289 to 1617711)