Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 1634014
End position: 1634037
Length: 24

DNA sequence
>NC_007626, from 1634014 to 1634037 (24 bp); Magnetospirillum magneticum AMB-1 TGTTGTTCTTGTTGTTGTTGTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1632862-1634274	Sequence	amb1494 - retron-type reverse transcriptase (Protein is coded in complementary strand; from 1634274 to 1632862)