Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 1634668
End position: 1634691
Length: 24

DNA sequence
>NC_007626, from 1634668 to 1634691 (24 bp); Magnetospirillum magneticum AMB-1 GGATAAAGGGTTAAAGGGCTAAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1634687-1635226	Sequence	amb1496 - hypothetical protein (Protein is coded in complementary strand; from 1635226 to 1634687)