Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 1641797
End position: 1641820
Length: 24

DNA sequence
>NC_007626, from 1641797 to 1641820 (24 bp); Magnetospirillum magneticum AMB-1 CGGCGGCGGCGGCGACGGCGACGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1641625-1642128	Sequence	amb1508 - hypothetical protein (Protein is coded in complementary strand; from 1642128 to 1641625)