Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 1749960
End position: 1749983
Length: 24

DNA sequence
>NC_007626, from 1749960 to 1749983 (24 bp); Magnetospirillum magneticum AMB-1 CGGCGGCGGCGGTGGCGGCGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1749902-1750138	Sequence	amb1620 - hypothetical protein (Protein is coded in complementary strand; from 1750138 to 1749902)