Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 1997496
End position: 1997519
Length: 24

DNA sequence
>NC_007626, from 1997496 to 1997519 (24 bp); Magnetospirillum magneticum AMB-1 GATGGGGAAGGGGGTGGGGCTGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1997392-1998546	Sequence	amb1856 - putative protein-tyrosine sulfotransferase (Protein is coded in complementary strand; from 1998546 to 1997392)