Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 2106807
End position: 2106830
Length: 24

DNA sequence
>NC_007626, from 2106807 to 2106830 (24 bp); Magnetospirillum magneticum AMB-1 TAGGCCTTGGCCGAGGCCTCGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2106651-2107286	Sequence	amb1953 - peptide methionine sulfoxide reductase (Protein is coded in complementary strand; from 2107286 to 2106651)