Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 2242983
End position: 2243006
Length: 24

DNA sequence
>NC_007626, from 2242983 to 2243006 (24 bp); Magnetospirillum magneticum AMB-1 GACGATGACGTTGACGAGGGCGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2242348-2243085	Sequence	amb2059 - hypothetical protein (Protein is coded in complementary strand; from 2243085 to 2242348)