Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 2586916
End position: 2586939
Length: 24

DNA sequence
>NC_007626, from 2586916 to 2586939 (24 bp); Magnetospirillum magneticum AMB-1 GCCACCACCACCACCACCGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2586806-2587309	Sequence	amb2379 - single-stranded DNA-binding protein (Protein is coded in complementary strand; from 2587309 to 2586806)