Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 2781100
End position: 2781123
Length: 24

DNA sequence
>NC_007626, from 2781100 to 2781123 (24 bp); Magnetospirillum magneticum AMB-1 CGAGGCCGTGGCCGACGCCGATGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2781078-2782274	Sequence	amb2595 - acetyl-CoA acetyltransferase (Protein is coded in complementary strand; from 2782274 to 2781078)