Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 2934517
End position: 2934540
Length: 24

DNA sequence
>NC_007626, from 2934517 to 2934540 (24 bp); Magnetospirillum magneticum AMB-1 GGCGCCGTCGCCGCCGCCGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2931140-2934877	Sequence	amb2746 - ribonucleotide-diphosphate reductase subunit alpha