Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 3476644
End position: 3476667
Length: 24

DNA sequence
>NC_007626, from 3476644 to 3476667 (24 bp); Magnetospirillum magneticum AMB-1 GCCTGGGCCTGCGCCTCGGCCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3476227-3477294	Sequence	amb3208 - hypothetical protein (Protein is coded in complementary strand; from 3477294 to 3476227)