Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 3543110
End position: 3543133
Length: 24

DNA sequence
>NC_007626, from 3543110 to 3543133 (24 bp); Magnetospirillum magneticum AMB-1 CGGCGGTGGCGGCGGCGGCGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3542385-3548582	Sequence	amb3275 - RTX toxins and related Ca2+-binding protein (Protein is coded in complementary strand; from 3548582 to 3542385)