Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 3635465
End position: 3635488
Length: 24

DNA sequence
>NC_007626, from 3635465 to 3635488 (24 bp); Magnetospirillum magneticum AMB-1 CGGCAGCGGCGGCGGCGGCGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3634918-3635526	Sequence	amb3345 - hypothetical protein (Protein is coded in complementary strand; from 3635526 to 3634918)